Regulon of NrtR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1995
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 4.7 Sequence: ATATTTGAGTTTAAAAATATT Position: -60 Score: 7.2 Sequence: ATAGTTTATAATAAAAACATA Locus tag: SGO_1997 Name: nadR Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) Locus tag: SGO_1996 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC-like Locus tag: SGO_1995 Name: nrtR Funciton: NAD biosynthesis transcriptional regulator NrtR, NrtR family
	SGO_1997	nadR	Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
	SGO_1996	pnuC	Ribosyl nicotinamide transporter, PnuC-like
	SGO_1995	nrtR	NAD biosynthesis transcriptional regulator NrtR, NrtR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD