Regulog NrtR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | 3 | 1 |
| Streptococcus mitis B6 | 3 | 1 |
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | 3 | 1 |
| Streptococcus suis 05ZYH33 | 4 | 1 |
| Streptococcus thermophilus CNRZ1066 | 2 | 1 |
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| nadR |
|
|
|
|
|
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -121 score = 4.6622 sequence = ATATTTGAGTTTAAAAATATT Site: position = -60 score = 7.20481 sequence = ATAGTTTATAATAAAAACATA Gene: SGO_1997: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
*
Streptococcus mitis B6 Site: position = -47 score = 6.9006 sequence = ATAGTTTATAATAAAAATATC Site: position = -84 score = 4.9128 sequence = ATAAAAAATAATAAAAACCTA Gene: smi_2044: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
|
|
|
*
Streptococcus sanguinis SK36 Site: position = -61 score = 7.08926 sequence = ATAGTTTATAATAAAATCATA Gene: SSA_2195: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
*2
Streptococcus suis 05ZYH33 Site: position = -90 score = 4.60859 sequence = ATCTTTTTATAAAAAAATATA Gene: SSU05_1974: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) Gene: SSU05_1973: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -26 score = 5.84173 sequence = TTACTATATTTAAAAAGGATA Gene: str0429: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
|
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) |
| pnuC |
|
|
|
|
|
|
Gene: SGO_1996: Ribosyl nicotinamide transporter, PnuC-like |
Gene: smi_2043: Ribosyl nicotinamide transporter, PnuC-like |
|
|
|
Gene: SSA_2194: Ribosyl nicotinamide transporter, PnuC-like |
Gene: SSU05_1972: Ribosyl nicotinamide transporter, PnuC-like |
|
|
Ribosyl nicotinamide transporter, PnuC-like |
| nrtR |
|
|
|
|
|
|
Gene: SGO_1995: NAD biosynthesis transcriptional regulator NrtR, NrtR family |
Gene: smi_2042: NAD biosynthesis transcriptional regulator NrtR, NrtR family |
|
|
|
Gene: SSA_2193: NAD biosynthesis transcriptional regulator NrtR, NrtR family |
Gene: SSU05_1971: NAD biosynthesis transcriptional regulator NrtR, NrtR family |
Gene: str0428: NAD biosynthesis transcriptional regulator NrtR, NrtR family |
|
NAD biosynthesis transcriptional regulator NrtR, NrtR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |