Regulon of MalR in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_0172
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Lactobacillaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 6 Sequence: TTACGAAAACGCTTGCGAAA Position: -74 Score: 4.9 Sequence: TTGCGAAAGCGTTTGCACAG Locus tag: lp_0175 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: lp_0176 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: lp_0177 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: lp_0178 Name: malA Funciton: Maltodextrose utilization protein MalA
	lp_0175	malX	Maltose/maltodextrin ABC transporter, substrate-binding protein
	lp_0176	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	lp_0177	malD	Maltose/maltodextrin ABC transporter, permease protein 2
	lp_0178	malA	Maltodextrose utilization protein MalA
Position: -77 Score: 6.2 Sequence: TTATGCAATCGCTTGCAATA Locus tag: lp_0172 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family Locus tag: lp_0173 Name: mdxR Funciton: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family Locus tag: lp_0174 Name: agl1 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
	lp_0172	malR	Maltose utilization transcriptional regulator MalR, LacI family
	lp_0173	mdxR	Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
	lp_0174	agl1	Oligo-1,6-glucosidase (EC 3.2.1.10)
Position: -87 Score: 6.3 Sequence: TCACGCAAACGCTTGCATAA Locus tag: lp_1729 Name: malT Funciton: Predicted maltose/maltodextrin permease Locus tag: lp_1730 Name: mapA Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64) Locus tag: lp_1731 Name: galM Funciton: Aldose 1-epimerase
	lp_1729	malT	Predicted maltose/maltodextrin permease
	lp_1730	mapA	Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
	lp_1731	galM	Aldose 1-epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD