Regulon of CopR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_1646
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.1 Sequence: AAGTTTACAAATGTAGTCTA Position: -35 Score: 5.9 Sequence: AAGATTACATTTGTAAACAG Locus tag: PEPE_1646 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: PEPE_1645 Name: copB Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	PEPE_1646	copR	Copper transport transcriptional regulator CopR, CopY family
	PEPE_1645	copB	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD