Regulon of CopR in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_1745, LSEI_A02
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.4 Sequence: GTGACTACAGTTGTAAACTA Position: -46 Score: 4.6 Sequence: GAGACTACAAACGTAAACTT Locus tag: LSEI_A02 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: LSEI_A01 Name: copB Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	LSEI_A02	copR	Copper transport transcriptional regulator CopR, CopY family
	LSEI_A01	copB	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -59 Score: 5 Sequence: TGGTTTACAGTTGTAAATTA Position: -29 Score: 6.1 Sequence: TAGATTACAGATGTAAACGG Locus tag: LSEI_1745 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: LSEI_1744 Name: LSEI_1744 Funciton: Hypothetical protein Locus tag: LSEI_1743 Name: copB Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	LSEI_1745	copR	Copper transport transcriptional regulator CopR, CopY family
	LSEI_1744	LSEI_1744	Hypothetical protein
	LSEI_1743	copB	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD