Regulon of CopR in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_0270
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -184 Score: 5.1 Sequence: TCGTTGACAGATGTAAACGA Position: -139 Score: 5.7 Sequence: AGGATTACATTTGTAAACAA Locus tag: LVIS_0274 Name: copA2 Funciton: Copper-exporting ATPase (EC 3.6.3.4) Locus tag: LVIS_0273 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	LVIS_0274	copA2	Copper-exporting ATPase (EC 3.6.3.4)
	LVIS_0273	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -68 Score: 5.4 Sequence: ATGACTACAGATGTAGACTC Position: -35 Score: 6 Sequence: AAGATTACATTTGTAGTCTA Locus tag: LVIS_0270 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: LVIS_0269 Name: copB Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	LVIS_0270	copR	Copper transport transcriptional regulator CopR, CopY family
	LVIS_0269	copB	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD