Regulon of RutR2 in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR2 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -266 Score: 6.6 Sequence: TCCTGTCAGTCCTGACAAGA Locus tag: PP4035 Name: pydP Funciton: Pyrimidine permease in reductive pathway Locus tag: PP4034 Name: pydC Funciton: Beta-ureidopropionase (EC 3.5.1.6)
	PP4035	pydP	Pyrimidine permease in reductive pathway
	PP4034	pydC	Beta-ureidopropionase (EC 3.5.1.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD