Regulon of Desal_3745 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_3745
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport
Effector:
Regulog:	Desal_3745 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/Others
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -235 Score: 6.3 Sequence: TTTGACTGCATACAATGTCAAG Locus tag: Desal_3746 Name: null Funciton: Lysine exporter protein (LYSE/YGGA)
	Desal_3746		Lysine exporter protein (LYSE/YGGA)
Position: -37 Score: 6.3 Sequence: CTTGACATTGTATGCAGTCAAA Locus tag: Desal_3745 Name: null Funciton: Transcriptional regulator, GntR family
	Desal_3745		Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD