Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator Desal_3745 in Desulfovibrionales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Metabolite transport
Effector:
Regulog: Desal_3745 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio salexigens DSM 2638
Desal_3746 null -235 6.3 TTTGACTGCATACAATGTCAAG
Desal_3745 null -37 6.3 CTTGACATTGTATGCAGTCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise