Profile of regulator Desal_3745 in Desulfovibrionales
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Metabolite transport |
| Effector: | |
| Regulog: | Desal_3745 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
- By pathway - Metabolite transport
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio salexigens DSM 2638 | |||||
| Desal_3746 | null | -235 | 6.3 | TTTGACTGCATACAATGTCAAG | |
| Desal_3745 | null | -37 | 6.3 | CTTGACATTGTATGCAGTCAAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |