Regulon of DvMF_1994 in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	DvMF_1994 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - GntR/Others
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 4.7 Sequence: GTCTTATACCTGATGCAATAT Locus tag: Ddes_2374 Name: null Funciton: D-galactarate dehydratase/altronate hydrolase-like protein Locus tag: Ddes_2375 Name: DvMF_2005 Funciton: Altronate hydrolase (EC 4.2.1.7)
	Ddes_2374		D-galactarate dehydratase/altronate hydrolase-like protein
	Ddes_2375	DvMF_2005	Altronate hydrolase (EC 4.2.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD