Regulog DvMF_1994 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - GntR/Others
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | 2 | 1 |
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | 5 | 3 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DvMF_1994 |
|
|
|
|
|
|
|
|
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -65 score = 5.43609 sequence = ATCTTATATTTTTTGCAAGAC Gene: DvMF_1994: transcriptional regulator, GntR family |
|
transcriptional regulator, GntR family |
| CRON 2. | |||||||||||
| DvMF_2004 |
Gene: Dret_2325: D-galactarate dehydratase/altronate hydrolase-like protein |
Gene: Dbac_2155: D-galactarate dehydratase/altronate hydrolase-like protein |
|
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Site: position = -136 score = 4.68536 sequence = GTCTTATACCTGATGCAATAT Gene: Ddes_2374: D-galactarate dehydratase/altronate hydrolase-like protein |
|
|
|
|
*2
Desulfovibrio vulgaris str. Miyazaki F Site: position = -57 score = 6.27661 sequence = GTCTTGCATAAGACATCATAC Gene: DvMF_2006: D-galactarate dehydratase/altronate hydrolase-like protein Site: position = -56 score = 6.27661 sequence = GTCTTGCATAAGACATCATAC Gene: DvMF_2004: D-galactarate dehydratase/altronate hydrolase-like protein |
|
D-galactarate dehydratase/altronate hydrolase-like protein |
| DvMF_2005 |
Gene: Dret_2324: Altronate hydrolase (EC 4.2.1.7) |
Gene: Dbac_2156: Altronate hydrolase (EC 4.2.1.7) |
|
Gene: Ddes_2375: Altronate hydrolase (EC 4.2.1.7) |
|
|
|
|
2
Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2003: Altronate hydrolase (EC 4.2.1.7) Gene: DvMF_2005: Altronate hydrolase (EC 4.2.1.7) |
|
Altronate hydrolase (EC 4.2.1.7) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |