Regulon of PhnF in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_3772
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 6.8 Sequence: TCTAAACGTCTAGACGTTTGTA Locus tag: Bphy_3772 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: Bphy_3771 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: Bphy_3770 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
	Bphy_3772	phnF	Transcriptional regulator for phosphonate utilization, GntR family
	Bphy_3771	rcsF	Protein RcsF involved in phosphonates utilization
	Bphy_3770	phnN	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Position: -90 Score: 6.8 Sequence: TACAAACGTCTAGACGTTTAGA Locus tag: Bphy_3773 Name: phnG Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Locus tag: Bphy_3774 Name: phnH Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Locus tag: Bphy_3775 Name: phnI Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Locus tag: Bphy_3776 Name: phnJ Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Locus tag: Bphy_3777 Name: phnK Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Locus tag: Bphy_3778 Name: phnL Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Locus tag: Bphy_3779 Name: phnM Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
	Bphy_3773	phnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
	Bphy_3774	phnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
	Bphy_3775	phnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
	Bphy_3776	phnJ	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
	Bphy_3777	phnK	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
	Bphy_3778	phnL	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
	Bphy_3779	phnM	Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Position: -111 Score: 4.7 Sequence: TGCAAAGATATAGTCGTCTAGA Position: -103 Score: 4.9 Sequence: TATAGTCGTCTAGATGTTGCGA Locus tag: Bphy_4623 Name: phnC Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) Locus tag: Bphy_4622 Name: phnD Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) Locus tag: Bphy_4621 Name: phnE Funciton: Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)
	Bphy_4623	phnC	Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
	Bphy_4622	phnD	Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
	Bphy_4621	phnE	Phosphonate ABC transporter permease protein phnE (TC 3.A.1.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD