Regulon of PhnF in Cupriavidus taiwanensis

Properties
Regulator type:	Transcription factor
TF locus tag:	RALTA_B1192
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Ralstonia
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - PhnF
By taxonomy - Ralstonia
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -23 Score: 7 Sequence: TCTAAACGTATAGACGTATAGG Locus tag: RALTA_B1191 Name: phnG Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Locus tag: RALTA_B1190 Name: phnH Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Locus tag: RALTA_B1189 Name: phnI Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Locus tag: RALTA_B1188 Name: phnJ Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Locus tag: RALTA_B1187 Name: phnK Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Locus tag: RALTA_B1186 Name: phnL Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Locus tag: RALTA_B1185 Name: phnM Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
	RALTA_B1191	phnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
	RALTA_B1190	phnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
	RALTA_B1189	phnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
	RALTA_B1188	phnJ	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
	RALTA_B1187	phnK	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
	RALTA_B1186	phnL	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
	RALTA_B1185	phnM	Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
Position: -174 Score: 7 Sequence: CCTATACGTCTATACGTTTAGA Locus tag: RALTA_B1192 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: RALTA_B1193 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: RALTA_B1194 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
	RALTA_B1192	phnF	Transcriptional regulator for phosphonate utilization, GntR family
	RALTA_B1193	rcsF	Protein RcsF involved in phosphonates utilization
	RALTA_B1194	phnN	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD