Regulog PhnF - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - PhnF
By taxonomy - Ralstonia
By TF family - GntR/Others
By pathway - Phosphonate utilization

Statistics of regulated genes
Genome	Genes	Operons
Ralstonia solanacearum GMI1000
Ralstonia pickettii 12J
Ralstonia metallidurans CH34	11	2
Ralstonia eutropha JMP134	11	2
Ralstonia eutropha H16	10	2
Cupriavidus taiwanensis	10	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
phnG	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	* Ralstonia metallidurans CH34 Site: position = -29 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: Rmet_0766: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Ralstonia eutropha JMP134 Site: position = -29 score = 6.7315 sequence = TCTACACGTATAGACGTATAGG Gene: Reut_B4186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Ralstonia eutropha H16 Site: position = -26 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: H16_B1288: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	* Cupriavidus taiwanensis Site: position = -23 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: RALTA_B1191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
phnH	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0765: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Ralstonia eutropha JMP134 Gene: Reut_B4187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Ralstonia eutropha H16 Gene: H16_B1287: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Cupriavidus taiwanensis Gene: RALTA_B1190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
phnI	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Ralstonia eutropha JMP134 Gene: Reut_B4188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Ralstonia eutropha H16 Gene: H16_B1286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Cupriavidus taiwanensis Gene: RALTA_B1189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
phnJ	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Ralstonia eutropha JMP134 Gene: Reut_B4189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Ralstonia eutropha H16 Gene: H16_B1285: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Cupriavidus taiwanensis Gene: RALTA_B1188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
phnK	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Ralstonia eutropha JMP134 Gene: Reut_B4190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Ralstonia eutropha H16 Gene: H16_B1284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Cupriavidus taiwanensis Gene: RALTA_B1187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
phnL	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Ralstonia eutropha JMP134 Gene: Reut_B4191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Ralstonia eutropha H16 Gene: H16_B1283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Cupriavidus taiwanensis Gene: RALTA_B1186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL	Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
phnM	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0760: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Ralstonia eutropha JMP134 Gene: Reut_B4192: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Ralstonia eutropha H16 Gene: H16_B1282: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Cupriavidus taiwanensis Gene: RALTA_B1185: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase

CRON 2.
phnF	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	* Ralstonia metallidurans CH34 Site: position = -155 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: Rmet_0767: Transcriptional regulator for phosphonate utilization, GntR family	* Ralstonia eutropha JMP134 Site: position = -243 score = 6.7315 sequence = CCTATACGTCTATACGTGTAGA Gene: Reut_B4185: Transcriptional regulator for phosphonate utilization, GntR family	* Ralstonia eutropha H16 Site: position = -174 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: H16_B1289: Transcriptional regulator for phosphonate utilization, GntR family	* Cupriavidus taiwanensis Site: position = -174 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: RALTA_B1192: Transcriptional regulator for phosphonate utilization, GntR family	Transcriptional regulator for phosphonate utilization, GntR family
phnM	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J Gene: Rpic_0507: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Ralstonia metallidurans CH34 Gene: Rmet_0768: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Ralstonia eutropha JMP134 Gene: Reut_B4184: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase	Ralstonia eutropha H16	Cupriavidus taiwanensis	Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
rcsF	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J Gene: Rpic_0506: Protein RcsF involved in phosphonates utilization	Ralstonia metallidurans CH34 Gene: Rmet_0769: Protein RcsF involved in phosphonates utilization	Ralstonia eutropha JMP134 Gene: Reut_B4183: Protein RcsF involved in phosphonates utilization	Ralstonia eutropha H16 Gene: H16_B1290: Protein RcsF involved in phosphonates utilization	Cupriavidus taiwanensis Gene: RALTA_B1193: Protein RcsF involved in phosphonates utilization	Protein RcsF involved in phosphonates utilization
phnN	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34 Gene: Rmet_0770: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Ralstonia eutropha JMP134 Gene: Reut_B4182: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Ralstonia eutropha H16 Gene: H16_B1291: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Cupriavidus taiwanensis Gene: RALTA_B1194: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PhnF - Ralstonia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --