Regulog PhnF - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PhnF
- By taxonomy - Ralstonia
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | ||
| Ralstonia pickettii 12J | ||
| Ralstonia metallidurans CH34 | 11 | 2 |
| Ralstonia eutropha JMP134 | 11 | 2 |
| Ralstonia eutropha H16 | 10 | 2 |
| Cupriavidus taiwanensis | 10 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| phnG |
|
|
*
Ralstonia metallidurans CH34 Site: position = -29 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: Rmet_0766: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Ralstonia eutropha JMP134 Site: position = -29 score = 6.7315 sequence = TCTACACGTATAGACGTATAGG Gene: Reut_B4186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Ralstonia eutropha H16 Site: position = -26 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: H16_B1288: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
*
Cupriavidus taiwanensis Site: position = -23 score = 7.02863 sequence = TCTAAACGTATAGACGTATAGG Gene: RALTA_B1191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG |
| phnH |
|
|
Gene: Rmet_0765: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: Reut_B4187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: H16_B1287: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Gene: RALTA_B1190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH |
| phnI |
|
|
Gene: Rmet_0764: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: Reut_B4188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: H16_B1286: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Gene: RALTA_B1189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI |
| phnJ |
|
|
Gene: Rmet_0763: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: Reut_B4189: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: H16_B1285: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Gene: RALTA_B1188: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ |
| phnK |
|
|
Gene: Rmet_0762: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: Reut_B4190: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: H16_B1284: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Gene: RALTA_B1187: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK |
| phnL |
|
|
Gene: Rmet_0761: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: Reut_B4191: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: H16_B1283: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Gene: RALTA_B1186: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL |
| phnM |
|
|
Gene: Rmet_0760: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: Reut_B4192: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: H16_B1282: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: RALTA_B1185: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
| CRON 2. | |||||||
| phnF |
|
|
*
Ralstonia metallidurans CH34 Site: position = -155 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: Rmet_0767: Transcriptional regulator for phosphonate utilization, GntR family |
*
Ralstonia eutropha JMP134 Site: position = -243 score = 6.7315 sequence = CCTATACGTCTATACGTGTAGA Gene: Reut_B4185: Transcriptional regulator for phosphonate utilization, GntR family |
*
Ralstonia eutropha H16 Site: position = -174 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: H16_B1289: Transcriptional regulator for phosphonate utilization, GntR family |
*
Cupriavidus taiwanensis Site: position = -174 score = 7.02863 sequence = CCTATACGTCTATACGTTTAGA Gene: RALTA_B1192: Transcriptional regulator for phosphonate utilization, GntR family |
Transcriptional regulator for phosphonate utilization, GntR family |
| phnM |
|
Gene: Rpic_0507: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: Rmet_0768: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
Gene: Reut_B4184: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
|
|
Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase |
| rcsF |
|
Gene: Rpic_0506: Protein RcsF involved in phosphonates utilization |
Gene: Rmet_0769: Protein RcsF involved in phosphonates utilization |
Gene: Reut_B4183: Protein RcsF involved in phosphonates utilization |
Gene: H16_B1290: Protein RcsF involved in phosphonates utilization |
Gene: RALTA_B1193: Protein RcsF involved in phosphonates utilization |
Protein RcsF involved in phosphonates utilization |
| phnN |
|
|
Gene: Rmet_0770: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: Reut_B4182: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: H16_B1291: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Gene: RALTA_B1194: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |