Regulon of RutR in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_0065
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Moraxellaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Moraxellaceae
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 5.3 Sequence: ATTATACCGATCGTTAAAAA Locus tag: AB57_3907 Name: rutG2 Funciton: Uracil permease
	AB57_3907	rutG2	Uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD