Regulog RutR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Moraxellaceae
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | 8 | 4 |
| Acinetobacter baumannii AB0057 | 1 | 1 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| rutA |
*
Acinetobacter sp. ADP1 Site: position = 15 score = 4.27133 sequence = TTTTGCCCCATCGGAAACAA Site: position = -193 score = 6.24061 sequence = ATTTTACTAAATGGTAAAAA Gene: ACIAD0027: Pyrimidine oxygenase |
|
|
|
Pyrimidine oxygenase |
| rutB |
Gene: ACIAD0028: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
Gene: ACIAD0029: Aminoacrylate peracid reductase |
|
|
|
Aminoacrylate peracid reductase |
| rutF |
Gene: ACIAD0030: Flavin reductase |
|
|
|
Flavin reductase |
| rutG |
Gene: ACIAD0031: Uracil permease |
|
|
|
Uracil permease |
| CRON 2. | |||||
| rutR |
*
Acinetobacter sp. ADP1 Site: position = -279 score = 6.0176 sequence = TTTTTACCATTTAGTAAAAT Gene: ACIAD0026: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: AB57_0065: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 3. | |||||
| rutG2 |
*
Acinetobacter sp. ADP1 Site: position = -176 score = 5.44411 sequence = TTTTTATTCATTGGTCAAAA Site: position = -129 score = 6.15035 sequence = TATTTACCATTTGGTAAAAT Gene: ACIAD3628: Uracil permease |
*
Acinetobacter baumannii AB0057 Site: position = -116 score = 5.31137 sequence = ATTATACCGATCGTTAAAAA Gene: AB57_3907: Uracil permease |
|
|
Uracil permease |
| CRON 4. | |||||
| rutD |
*
Acinetobacter sp. ADP1 Site: position = -20 score = 6.13625 sequence = ATTTTACCAAATGGTTAAAA Site: position = -19 score = 4.24972 sequence = TTTTACCAAATGGTTAAAAA Gene: ACIAD0025: Aminoacrylate hydrolase |
|
|
|
Aminoacrylate hydrolase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |