Regulon of RutR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_18369
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Psychromonadaceae/Aeromonadales
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -155 Score: 4.1 Sequence: AACTGACTCCCGGGTCAAGT Locus tag: PE36_18369 Name: rutR Funciton: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
	PE36_18369	rutR	Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Position: -146 Score: 4.7 Sequence: ACTTGTCCCAAGGGTCAAGT Locus tag: PE36_22205 Name: gpt Funciton: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
	PE36_22205	gpt	Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22)
Position: -118 Score: 5.1 Sequence: ACTTGACTCGAGGGTCAGGT Locus tag: PE36_18399 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PE36_18394 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PE36_18389 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PE36_18384 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PE36_18399	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PE36_18394	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PE36_18389	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PE36_18384	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -379 Score: 5.3 Sequence: TATTGACCATCAAGTCAATT Locus tag: PE36_19145 Name: pbuT Funciton: Xanthine/uracil permease Locus tag: PE36_19150 Name: xpt Funciton: Xanthine phosphoribosyltransferase (EC 2.4.2.22)
	PE36_19145	pbuT	Xanthine/uracil permease
	PE36_19150	xpt	Xanthine phosphoribosyltransferase (EC 2.4.2.22)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD