Regulog RutR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | 8 | 4 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| rutR |
|
|
*
Moritella sp. PE36 Site: position = -155 score = 4.12949 sequence = AACTGACTCCCGGGTCAAGT Gene: PE36_18369: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
|
|
|
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 2. | |||||||
| pbuT |
|
|
*
Moritella sp. PE36 Site: position = -379 score = 5.29469 sequence = TATTGACCATCAAGTCAATT Gene: PE36_19145: Xanthine/uracil permease |
|
|
|
Xanthine/uracil permease |
| xpt |
|
|
Gene: PE36_19150: Xanthine phosphoribosyltransferase (EC 2.4.2.22) |
|
|
|
Xanthine phosphoribosyltransferase (EC 2.4.2.22) |
| CRON 3. | |||||||
| xdhA |
|
|
*
Moritella sp. PE36 Site: position = -118 score = 5.11861 sequence = ACTTGACTCGAGGGTCAGGT Gene: PE36_18399: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
|
|
|
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
| xdhB |
|
|
Gene: PE36_18394: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
|
|
|
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
| xdhC |
|
|
Gene: PE36_18389: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
|
|
|
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
| guaD |
|
|
Gene: PE36_18384: Guanine deaminase (EC 3.5.4.3) |
|
|
|
Guanine deaminase (EC 3.5.4.3) |
| CRON 4. | |||||||
| gpt |
|
|
*
Moritella sp. PE36 Site: position = -146 score = 4.74783 sequence = ACTTGTCCCAAGGGTCAAGT Gene: PE36_22205: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
Gene: AHA_3424: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
Gene: ASA_0890: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
Gene: Tola_0808: Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
Xanthine-guanine phosphoribosyltransferase (EC 2.4.2.22) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |