Regulon of PsrA in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC2014
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Xanthomonadales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.6 Sequence: ACTCAAACAATCGTTTGATT Locus tag: XAC2014 Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family Locus tag: XAC2013 Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: XAC2012 Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
	XAC2014	psrA	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
	XAC2013	fadB	Enoyl-CoA hydratase (EC 4.2.1.17)
	XAC2012	fadA	3-ketoacyl-CoA thiolase (EC 2.3.1.16)
Position: -96 Score: 5.1 Sequence: TTTAAAACAATCGTTTTAAA Locus tag: XAC0533 Name: aroQ Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10) Locus tag: XAC0532 Name: bccP Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase Locus tag: XAC0531 Name: null Funciton: 23S RNA associated protein Locus tag: XAC0530 Name: accC Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
	XAC0533	aroQ	3-dehydroquinate dehydratase II (EC 4.2.1.10)
	XAC0532	bccP	Biotin carboxyl carrier protein of acetyl-CoA carboxylase
	XAC0531		23S RNA associated protein
	XAC0530	accC	Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD