Regulog PsrA - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - PsrA
- By TF family - TetR
- By effector - Oleate
- By pathway - Fatty acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | ||
| Xanthomonas axonopodis pv. citri str. 306 | 7 | 2 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 7 | 2 |
| Stenotrophomonas maltophilia K279a | 7 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| psrA |
|
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -37 score = 5.56467 sequence = ACTCAAACAATCGTTTGATT Gene: XAC2014: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -37 score = 5.56467 sequence = ACTCAAACAATCGTTTGATT Gene: XCC1980: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
*
Stenotrophomonas maltophilia K279a Site: position = -35 score = 5.73595 sequence = TATCAAACAATCGTTTGATT Gene: Smlt2053: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
| fadB |
|
Gene: XAC2013: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: XCC1979: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Smlt2052: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| fadA |
|
Gene: XAC2012: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: XCC1978: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
Gene: Smlt2051: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
| CRON 2. | |||||
| aroQ |
Gene: XF0047: 3-dehydroquinate dehydratase II (EC 4.2.1.10) |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -96 score = 5.06225 sequence = TTTAAAACAATCGTTTTAAA Gene: XAC0533: 3-dehydroquinate dehydratase II (EC 4.2.1.10) |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -96 score = 5.45498 sequence = AATCAAACGATTGTTTAAAA Gene: XCC0518: 3-dehydroquinate dehydratase II (EC 4.2.1.10) |
*
Stenotrophomonas maltophilia K279a Site: position = -96 score = 5.29949 sequence = TTTCAAACGTTCGATTGAAA Gene: Smlt4239: 3-dehydroquinate dehydratase II (EC 4.2.1.10) |
3-dehydroquinate dehydratase II (EC 4.2.1.10) |
| bccP |
Gene: XF0048: Biotin carboxyl carrier protein of acetyl-CoA carboxylase |
Gene: XAC0532: Biotin carboxyl carrier protein of acetyl-CoA carboxylase |
Gene: XCC0517: Biotin carboxyl carrier protein of acetyl-CoA carboxylase |
Gene: Smlt4240: Biotin carboxyl carrier protein of acetyl-CoA carboxylase |
Biotin carboxyl carrier protein of acetyl-CoA carboxylase |
| XAC0531 |
|
Gene: XAC0531: 23S RNA associated protein |
Gene: XCC0516: 23S RNA associated protein |
|
23S RNA associated protein |
| accC |
Gene: XF0049: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) |
Gene: XAC0530: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) |
Gene: XCC0515: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) |
Gene: Smlt4241: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) |
Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14) |
| CRON 3. | |||||
| etfD |
Gene: XF1298: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Gene: XAC3575: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Gene: XCC0630: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
*
Stenotrophomonas maltophilia K279a Site: position = -84 score = 4.82845 sequence = ATTCAAACAACCGTTTCGCC Gene: Smlt0198: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |