Regulon of ModE in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2731
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Caulobacterales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Caulobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.4 Sequence: TTATGTAGTCAAGATACATAT Locus tag: Caul_2732 Name: modB Funciton: Molybdate ABC transporter, permease protein
	Caul_2732	modB	Molybdate ABC transporter, permease protein
Position: -64 Score: 5.4 Sequence: ATATGTATCTTGACTACATAA Locus tag: Caul_2731 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Caul_2731	modE	Molybdate-responsive transcriptional regulator ModE
Position: -89 Score: 6.5 Sequence: TTAGGCACTTGAACTACATAA Locus tag: Caul_1837 Name: modA Funciton: Molybdate ABC transporter, permease protein
	Caul_1837	modA	Molybdate ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD