Regulog ModE - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Caulobacterales
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 3 | 2 |
| Caulobacter segnis ATCC 21756 | ||
| Caulobacter sp. K31 | 3 | 3 |
| Phenylobacterium zucineum HLK1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| modA |
*
Caulobacter crescentus CB15 Site: position = -49 score = 6.46275 sequence = TTATGTAGTTTGGCTGCATAA Gene: CC0328: Molybdate ABC transporter, permease protein |
Gene: Cseg_3825: Molybdate ABC transporter, permease protein |
*
Caulobacter sp. K31 Site: position = -89 score = 6.46275 sequence = TTAGGCACTTGAACTACATAA Gene: Caul_1837: Molybdate ABC transporter, permease protein |
Gene: PHZ_c2286: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modB |
Gene: CC0329: Molybdate ABC transporter, permease protein |
Gene: Cseg_3824: Molybdate ABC transporter, permease protein |
*
Caulobacter sp. K31 Site: position = -102 score = 5.42771 sequence = TTATGTAGTCAAGATACATAT Gene: Caul_2732: Molybdate ABC transporter, permease protein |
Gene: PHZ_c2285: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| CRON 2. | |||||
| modE |
*
Caulobacter crescentus CB15 Site: position = 23 score = 6.46275 sequence = TTATGCAGCCAAACTACATAA Gene: CC0327: Molybdate-responsive transcriptional regulator ModE |
|
*
Caulobacter sp. K31 Site: position = -64 score = 5.42771 sequence = ATATGTATCTTGACTACATAA Gene: Caul_2731: Molybdate-responsive transcriptional regulator ModE |
|
Molybdate-responsive transcriptional regulator ModE |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |