Regulon of ModE in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_12629
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Vibrionales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 7.6 Sequence: CGATATGTAGTTTACTATATATCG Locus tag: VAS14_11339 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: VAS14_11344 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: VAS14_11349 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	VAS14_11339	modA	Molybdate ABC transporter, substrate-binding protein
	VAS14_11344	modB	Molybdate ABC transporter, permease protein
	VAS14_11349	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD