Statistics of regulated genes

Genome	Genes	Operons
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio vulnificus CMCP6
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14	3	1
Photobacterium profundum SS9	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
modA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0726: Molybdate ABC transporter, substrate-binding protein	Vibrio vulnificus CMCP6 Gene: VV20329: Molybdate ABC transporter, substrate-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05725: Molybdate ABC transporter, substrate-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0931: Molybdate ABC transporter, substrate-binding protein	Vibrio shilonii AK1 Gene: VSAK1_14847: Molybdate ABC transporter, substrate-binding protein	Vibrio splendidus LGP32 Gene: VS_II0723: Molybdate ABC transporter, substrate-binding protein	Vibrio fischeri ES114 Gene: VF_A0290: Molybdate ABC transporter, substrate-binding protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0782: Molybdate ABC transporter, substrate-binding protein	* Vibrio angustum S14 Site: position = -43 score = 7.64432 sequence = CGATATGTAGTTTACTATATATCG Gene: VAS14_11339: Molybdate ABC transporter, substrate-binding protein	* Photobacterium profundum SS9 Site: position = -50 score = 7.32705 sequence = CGATATGTAGTAAGGTATATATCG Gene: PBPRB1349: Molybdate ABC transporter, substrate-binding protein	Molybdate ABC transporter, substrate-binding protein
modB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0725: Molybdate ABC transporter, permease protein	Vibrio vulnificus CMCP6 Gene: VV20328: Molybdate ABC transporter, permease protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05726: Molybdate ABC transporter, permease protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0930: Molybdate ABC transporter, permease protein	Vibrio shilonii AK1 Gene: VSAK1_14842: Molybdate ABC transporter, permease protein	Vibrio splendidus LGP32 Gene: VS_II0724: Molybdate ABC transporter, permease protein	Vibrio fischeri ES114 Gene: VF_A0291: Molybdate ABC transporter, permease protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0781: Molybdate ABC transporter, permease protein	Vibrio angustum S14 Gene: VAS14_11344: Molybdate ABC transporter, permease protein	Photobacterium profundum SS9 Gene: PBPRB1348: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0724: Molybdate ABC transporter, ATP-binding protein	Vibrio vulnificus CMCP6 Gene: VV20327: Molybdate ABC transporter, ATP-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05727: Molybdate ABC transporter, ATP-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0929: Molybdate ABC transporter, ATP-binding protein	Vibrio shilonii AK1 Gene: VSAK1_14837: Molybdate ABC transporter, ATP-binding protein	Vibrio splendidus LGP32 Gene: VS_II0725: Molybdate ABC transporter, ATP-binding protein	Vibrio fischeri ES114 Gene: VF_A0292: Molybdate ABC transporter, ATP-binding protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0780: Molybdate ABC transporter, ATP-binding protein	Vibrio angustum S14 Gene: VAS14_11349: Molybdate ABC transporter, ATP-binding protein	Photobacterium profundum SS9 Gene: PBPRB1347: Molybdate ABC transporter, ATP-binding protein	Molybdate ABC transporter, ATP-binding protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD