Regulon of RbsR in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_0879
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.9 Sequence: GTACGCAAACGTTTGCGAAG Locus tag: Rpic_0882 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Rpic_0881 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Rpic_0880 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Rpic_0879 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: Rpic_0878 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	Rpic_0882	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	Rpic_0881	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	Rpic_0880	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	Rpic_0879	rbsR	Transcriptional repressor of ribose utilization, LacI family
	Rpic_0878	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD