Regulon of TyrR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_04363
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Psychromonadaceae/Aeromonadales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 4 Sequence: GTTGATACTGCCGTTTACAT Locus tag: PE36_04363 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	PE36_04363	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -196 Score: 4.6 Sequence: CTGTAAATATTAGTTTCCAA Position: -78 Score: 5.5 Sequence: TTGTAAACATAAGTTTACAC Locus tag: PE36_13494 Name: tyrP Funciton: Tyrosine-specific transport protein
	PE36_13494	tyrP	Tyrosine-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD