Regulon of NrtR2 in Cyanothece sp. PCC 7425

Properties
Regulator type:	Transcription factor
TF locus tag:	Cyan7425_2119
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR2 - Cyanobacteria
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.1 Sequence: ATAGTGTTATTGAGACACTAT Position: -26 Score: 5.9 Sequence: TTAGTGTAGTTTATACACAAA Locus tag: Cyan7425_2213 Name: null Funciton: hypothetical protein Locus tag: Cyan7425_2212 Name: draG Funciton: ADP-ribosylglycohydrolase superfamkily Locus tag: Cyan7425_2211 Name: null Funciton: hypothetical protein Locus tag: Cyan7425_2210 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) Locus tag: Cyan7425_2209 Name: null Funciton: hypothetical protein
	Cyan7425_2213		hypothetical protein
	Cyan7425_2212	draG	ADP-ribosylglycohydrolase superfamkily
	Cyan7425_2211		hypothetical protein
	Cyan7425_2210	pncA	Nicotinamidase (EC 3.5.1.19)
	Cyan7425_2209		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD