Regulog NrtR2 - Cyanobacteria

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Cyanothece sp. ATCC 51142
Cyanothece sp. PCC 7425	5	1
Cyanothece sp. PCC 8801
Gloeobacter violaceus PCC 7421
Microcystis aeruginosa NIES-843
Nostoc sp. PCC 7120
Prochlorococcus marinus str. MIT 9313
Synechococcus elongatus PCC 7942
Synechococcus sp. JA-3-3Ab
Synechococcus sp. PCC 7002	3	3
Synechococcus sp. WH 8102
Synechocystis sp. PCC 6803
Thermosynechococcus elongatus BP-1
Trichodesmium erythraeum IMS101

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes															Function

CRON 1.
Cyan7425_2213	Cyanothece sp. ATCC 51142	* Cyanothece sp. PCC 7425 Site: position = -49 score = 5.13245 sequence = ATAGTGTTATTGAGACACTAT Site: position = -26 score = 5.92812 sequence = TTAGTGTAGTTTATACACAAA Gene: Cyan7425_2213: hypothetical protein	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	hypothetical protein
draG	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425 Gene: Cyan7425_2212: ADP-ribosylglycohydrolase superfamkily	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr3188: ADP-ribosylglycohydrolase superfamkily	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	ADP-ribosylglycohydrolase superfamkily
Cyan7425_2211	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425 Gene: Cyan7425_2211: hypothetical protein	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	hypothetical protein
pncA	Cyanothece sp. ATCC 51142 Gene: cce_1052: Nicotinamidase (EC 3.5.1.19)	Cyanothece sp. PCC 7425 Gene: Cyan7425_2210: Nicotinamidase (EC 3.5.1.19)	Cyanothece sp. PCC 8801 Gene: PCC8801_3726: Nicotinamidase (EC 3.5.1.19)	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr5162: Nicotinamidase (EC 3.5.1.19)	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab Gene: CYA_1522: Nicotinamidase (EC 3.5.1.19)	* Synechococcus sp. PCC 7002 Site: position = -66 score = 4.18529 sequence = aatGTGTtttTaaaACACcAc Gene: SYNPCC7002_A0642: Nicotinamidase (EC 3.5.1.19)	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101 Gene: Tery_2452: Nicotinamidase (EC 3.5.1.19)	Nicotinamidase (EC 3.5.1.19)
Cyan7425_2209	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425 Gene: Cyan7425_2209: hypothetical protein	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab	Synechococcus sp. PCC 7002	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	hypothetical protein

CRON 2.
nadE	Cyanothece sp. ATCC 51142	Cyanothece sp. PCC 7425	Cyanothece sp. PCC 8801	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942 Gene: Synpcc7942_0105: NAD synthetase (EC 6.3.1.5)	Synechococcus sp. JA-3-3Ab	* Synechococcus sp. PCC 7002 Site: position = -123 score = 5.67676 sequence = TTGATGTAGAATCGACACTAA Gene: SYNPCC7002_A1784: NAD synthetase (EC 6.3.1.5)	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1	Trichodesmium erythraeum IMS101	NAD synthetase (EC 6.3.1.5)

CRON 3.
pncB	Cyanothece sp. ATCC 51142 Gene: cce_2759: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Cyanothece sp. PCC 7425 Gene: Cyan7425_2236: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Cyanothece sp. PCC 8801 Gene: PCC8801_0271: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Gloeobacter violaceus PCC 7421	Microcystis aeruginosa NIES-843	Nostoc sp. PCC 7120 Gene: alr2482: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Prochlorococcus marinus str. MIT 9313	Synechococcus elongatus PCC 7942	Synechococcus sp. JA-3-3Ab Gene: CYA_1521: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	* Synechococcus sp. PCC 7002 Site: position = -50 score = 5.54082 sequence = TTATTGTAAAATAAACACTAA Gene: SYNPCC7002_A0508: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Synechococcus sp. WH 8102	Synechocystis sp. PCC 6803	Thermosynechococcus elongatus BP-1 Gene: tlr1177: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Trichodesmium erythraeum IMS101 Gene: Tery_0318: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrtR2 - Cyanobacteria

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --