Profile of regulator NrtR2 in Cyanobacteria
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR2 - Cyanobacteria |
Member of regulog collections
- By taxonomy - Cyanobacteria
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Cyanothece sp. PCC 7425 | |||||
| Cyan7425_2213 | null | -49 | 5.1 | ATAGTGTTATTGAGACACTAT | |
| Cyan7425_2213 | null | -26 | 5.9 | TTAGTGTAGTTTATACACAAA | |
| Synechococcus sp. PCC 7002 | |||||
| SYNPCC7002_A1784 | nadE | -123 | 5.7 | TTGATGTAGAATCGACACTAA | |
| SYNPCC7002_A0508 | pncB | -50 | 5.5 | TTATTGTAAAATAAACACTAA | |
| SYNPCC7002_A0642 | pncA | -66 | 4.2 | aatGTGTtttTaaaACACcAc | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |