Regulon of NagC in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_0488
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagC - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - NagC
By TF family - ROK
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 5.3 Sequence: CAATTTTCAATTGTAAAATAA Locus tag: Ping_0489 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	Ping_0489	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD