Regulon of IscR in Geobacter sp. FRC-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Geob_1981
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Desulfuromonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 7 Sequence: ATAATTGACTGAAATAGTAAGGTAT Locus tag: Geob_1982 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30) Locus tag: Geob_1981 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Geob_1980 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Geob_1982	cysE	Serine acetyltransferase (EC 2.3.1.30)
	Geob_1981	iscR	Iron-sulfur cluster regulator IscR
	Geob_1980	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD