Regulon of IscR in Sphingomonas wittichii RW1

Properties
Regulator type:	Transcription factor
TF locus tag:	Swit_2919
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Sphingomonadales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.7 Sequence: CAATCGGATCGAATCAGTCCGATTG Locus tag: Swit_2919 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Swit_2918 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: Swit_2917 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: Swit_2916 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: Swit_2915 Name: sufS Funciton: Cysteine desulfurases, SufS subfamily Locus tag: Swit_2914 Name: sufT Funciton: Iron sulfur cluster assembly protein SufT Locus tag: Swit_2913 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
	Swit_2919	iscR	Iron-sulfur cluster regulator IscR
	Swit_2918	sufB	Iron-sulfur cluster assembly protein SufB
	Swit_2917	sufC	Iron-sulfur cluster assembly ATPase protein SufC
	Swit_2916	sufD	Iron-sulfur cluster assembly protein SufD
	Swit_2915	sufS	Cysteine desulfurases, SufS subfamily
	Swit_2914	sufT	Iron sulfur cluster assembly protein SufT
	Swit_2913	sufA	Iron binding protein SufA for iron-sulfur cluster assembly

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD