Regulog IscR - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594	11	1
Erythrobacter sp. NAP1	10	1
Novosphingobium aromaticivorans DSM 12444	8	1
Sphingopyxis alaskensis RB2256	9	1
Sphingobium japonicum UT26S	9	1
Sphingomonas wittichii RW1	7	1
Zymomonas mobilis subsp. mobilis ZM4	7	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
iscR	* Erythrobacter litoralis HTCC2594 Site: position = -40 score = 7.0465 sequence = AAATCGGAACGATTTGGTCCGATTT Gene: ELI_12790: Iron-sulfur cluster regulator IscR	* Erythrobacter sp. NAP1 Site: position = -61 score = 7.05614 sequence = AAATCCGACTGATTCAGTCCGATTT Gene: NAP1_13233: Iron-sulfur cluster regulator IscR	* Novosphingobium aromaticivorans DSM 12444 Site: position = -53 score = 7.07261 sequence = TAACCGGAGTGATTCGGTCCGATTT Gene: Saro_0194: Iron-sulfur cluster regulator IscR	* Sphingopyxis alaskensis RB2256 Site: position = -55 score = 5.61779 sequence = TAAGTGGAGTAATTTACTCTAGTTA Gene: Sala_0675: Iron-sulfur cluster regulator IscR	* Sphingobium japonicum UT26S Site: position = -51 score = 6.84792 sequence = CAATCGGATGGATTCGATCCGATTT Gene: SJA_C1-34000: Iron-sulfur cluster regulator IscR	* Sphingomonas wittichii RW1 Site: position = -38 score = 6.71651 sequence = CAATCGGATCGAATCAGTCCGATTG Gene: Swit_2919: Iron-sulfur cluster regulator IscR	* Zymomonas mobilis subsp. mobilis ZM4 Site: position = -111 score = 6.22362 sequence = TAATCAGACAAATTTAGTCTTGTTT Gene: ZMO0422: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
sufB	Erythrobacter litoralis HTCC2594 Gene: ELI_12785: Iron-sulfur cluster assembly protein SufB	Erythrobacter sp. NAP1 Gene: NAP1_13238: Iron-sulfur cluster assembly protein SufB	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0195: Iron-sulfur cluster assembly protein SufB	Sphingopyxis alaskensis RB2256 Gene: Sala_0674: Iron-sulfur cluster assembly protein SufB	Sphingobium japonicum UT26S Gene: SJA_C1-33990: Iron-sulfur cluster assembly protein SufB	Sphingomonas wittichii RW1 Gene: Swit_2918: Iron-sulfur cluster assembly protein SufB	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0423: Iron-sulfur cluster assembly protein SufB	Iron-sulfur cluster assembly protein SufB
ELI_12780	Erythrobacter litoralis HTCC2594 Gene: ELI_12780: Hypothetical protein	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Hypothetical protein
ycjD	Erythrobacter litoralis HTCC2594 Gene: ELI_12775: Conserved hypothetical protein	Erythrobacter sp. NAP1 Gene: NAP1_13243: Conserved hypothetical protein	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0196: Conserved hypothetical protein	2 Sphingopyxis alaskensis RB2256 Gene: Sala_0672: Conserved hypothetical protein Gene: Sala_0673: Conserved hypothetical protein	Sphingobium japonicum UT26S Gene: SJA_C1-33980: Conserved hypothetical protein	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Conserved hypothetical protein
ELI_12770	Erythrobacter litoralis HTCC2594 Gene: ELI_12770: Hypothetical protein	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Hypothetical protein
ELI_12765	Erythrobacter litoralis HTCC2594 Gene: ELI_12765: Conserved hypothetical protein	Erythrobacter sp. NAP1 Gene: NAP1_13248: Conserved hypothetical protein	Novosphingobium aromaticivorans DSM 12444	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Conserved hypothetical protein
sufC	Erythrobacter litoralis HTCC2594 Gene: ELI_12760: Iron-sulfur cluster assembly ATPase protein SufC	Erythrobacter sp. NAP1 Gene: NAP1_13253: Iron-sulfur cluster assembly ATPase protein SufC	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0197: Iron-sulfur cluster assembly ATPase protein SufC	Sphingopyxis alaskensis RB2256 Gene: Sala_0671: Iron-sulfur cluster assembly ATPase protein SufC	Sphingobium japonicum UT26S Gene: SJA_C1-33960: Iron-sulfur cluster assembly ATPase protein SufC	Sphingomonas wittichii RW1 Gene: Swit_2917: Iron-sulfur cluster assembly ATPase protein SufC	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0425: Iron-sulfur cluster assembly ATPase protein SufC	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Erythrobacter litoralis HTCC2594 Gene: ELI_12755: Iron-sulfur cluster assembly protein SufD	Erythrobacter sp. NAP1 Gene: NAP1_13263: Iron-sulfur cluster assembly protein SufD	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0198: Iron-sulfur cluster assembly protein SufD	Sphingopyxis alaskensis RB2256 Gene: Sala_0670: Iron-sulfur cluster assembly protein SufD	Sphingobium japonicum UT26S Gene: SJA_C1-33950: Iron-sulfur cluster assembly protein SufD	Sphingomonas wittichii RW1 Gene: Swit_2916: Iron-sulfur cluster assembly protein SufD	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0426: Iron-sulfur cluster assembly protein SufD	Iron-sulfur cluster assembly protein SufD
sufS	Erythrobacter litoralis HTCC2594 Gene: ELI_12750: Cysteine desulfurases, SufS subfamily	Erythrobacter sp. NAP1 Gene: NAP1_13268: Cysteine desulfurases, SufS subfamily	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0199: Cysteine desulfurases, SufS subfamily	Sphingopyxis alaskensis RB2256 Gene: Sala_0669: Cysteine desulfurases, SufS subfamily	Sphingobium japonicum UT26S Gene: SJA_C1-33940: Cysteine desulfurases, SufS subfamily	Sphingomonas wittichii RW1 Gene: Swit_2915: Cysteine desulfurases, SufS subfamily	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0427: Cysteine desulfurases, SufS subfamily	Cysteine desulfurases, SufS subfamily
sufT	Erythrobacter litoralis HTCC2594 Gene: ELI_12745: Iron sulfur cluster assembly protein SufT	Erythrobacter sp. NAP1 Gene: NAP1_13273: Iron sulfur cluster assembly protein SufT	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0200: Iron sulfur cluster assembly protein SufT	Sphingopyxis alaskensis RB2256 Gene: Sala_0668: Iron sulfur cluster assembly protein SufT	Sphingobium japonicum UT26S Gene: SJA_C1-33930: Iron sulfur cluster assembly protein SufT	Sphingomonas wittichii RW1 Gene: Swit_2914: Iron sulfur cluster assembly protein SufT	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0428: Iron sulfur cluster assembly protein SufT	Iron sulfur cluster assembly protein SufT
sufA	Erythrobacter litoralis HTCC2594 Gene: ELI_12740: Iron binding protein SufA for iron-sulfur cluster assembly	Erythrobacter sp. NAP1 Gene: NAP1_13278: Iron binding protein SufA for iron-sulfur cluster assembly	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0201: Iron binding protein SufA for iron-sulfur cluster assembly	Sphingopyxis alaskensis RB2256 Gene: Sala_0667: Iron binding protein SufA for iron-sulfur cluster assembly	Sphingobium japonicum UT26S Gene: SJA_C1-33920: Iron binding protein SufA for iron-sulfur cluster assembly	Sphingomonas wittichii RW1 Gene: Swit_2913: Iron binding protein SufA for iron-sulfur cluster assembly	Zymomonas mobilis subsp. mobilis ZM4 Gene: ZMO0429: Iron binding protein SufA for iron-sulfur cluster assembly	Iron binding protein SufA for iron-sulfur cluster assembly
NAP1_13258	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1 Gene: NAP1_13258: Hypothetical protein	Novosphingobium aromaticivorans DSM 12444	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Hypothetical protein
SJA_C1-33970	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444	Sphingopyxis alaskensis RB2256	Sphingobium japonicum UT26S Gene: SJA_C1-33970: Hypothetical protein	Sphingomonas wittichii RW1	Zymomonas mobilis subsp. mobilis ZM4	Hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Sphingomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --