Regulon of HutC in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_3862
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Moraxellaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6 Sequence: TAACTTGTATATACATGTTT Locus tag: AB57_1739 Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
	AB57_1739	COG1457 (CodB)	Permease, cytosine/purines, uracil, thiamine, allantoin family protein
Position: -90 Score: 5.6 Sequence: ATGGATGTATATACAAGTTA Locus tag: AB57_3860 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: AB57_3859 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: AB57_3858 Name: hisT Funciton: Histidine transport protein (permease) Locus tag: AB57_3857 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: AB57_3856 Name: hutG2 Funciton: Formiminoglutamase (EC 3.5.3.8)
	AB57_3860	hutU	Urocanate hydratase (EC 4.2.1.49)
	AB57_3859	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	AB57_3858	hisT	Histidine transport protein (permease)
	AB57_3857	hutI	Imidazolonepropionase (EC 3.5.2.7)
	AB57_3856	hutG2	Formiminoglutamase (EC 3.5.3.8)
Position: -67 Score: 4.5 Sequence: GTGGTTGTATATACATAGCA Locus tag: AB57_3862 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: AB57_3861 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
	AB57_3862	hutC	Histidine utilization repressor, GntR family
	AB57_3861	hutD	Conserved hypothetical protein related to histidine degradation

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD