Regulog HutC - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | ||
| Acinetobacter baumannii AB0057 | 8 | 3 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 | 6 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| hutU |
Gene: ACIAD1166: Urocanate hydratase (EC 4.2.1.49) |
*
Acinetobacter baumannii AB0057 Site: position = -90 score = 5.62135 sequence = ATGGATGTATATACAAGTTA Gene: AB57_3860: Urocanate hydratase (EC 4.2.1.49) |
|
*
Psychrobacter sp. PRwf-1 Site: position = -54 score = 4.99599 sequence = TAATTTGTATATACAAAATC Gene: PsycPRwf_0852: Urocanate hydratase (EC 4.2.1.49) |
Urocanate hydratase (EC 4.2.1.49) |
| hutH |
Gene: ACIAD1167: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: AB57_3859: Histidine ammonia-lyase (EC 4.3.1.3) |
|
Gene: PsycPRwf_0850: Histidine ammonia-lyase (EC 4.3.1.3) |
Histidine ammonia-lyase (EC 4.3.1.3) |
| hisT |
Gene: ACIAD1168: Histidine transport protein (permease) |
Gene: AB57_3858: Histidine transport protein (permease) |
|
|
Histidine transport protein (permease) |
| hutI |
|
Gene: AB57_3857: Imidazolonepropionase (EC 3.5.2.7) |
|
Gene: PsycPRwf_0848: Imidazolonepropionase (EC 3.5.2.7) |
Imidazolonepropionase (EC 3.5.2.7) |
| hutG2 |
Gene: ACIAD1169: Formiminoglutamase (EC 3.5.3.8) |
Gene: AB57_3856: Formiminoglutamase (EC 3.5.3.8) |
|
Gene: PsycPRwf_0849: Formiminoglutamase (EC 3.5.3.8) |
Formiminoglutamase (EC 3.5.3.8) |
| COG3314 |
|
|
|
*2
Psychrobacter sp. PRwf-1 Gene: PsycPRwf_1490: Predicted histidine uptake transporter Site: position = -207 score = 4.00756 sequence = TAATTTGTCTATAGACATAG Site: position = -28 score = 4.02574 sequence = TTATTGCTACAGACAAGGAT Gene: PsycPRwf_0851: Predicted histidine uptake transporter |
Predicted histidine uptake transporter |
| CRON 2. | |||||
| COG1457 (CodB) |
|
*
Acinetobacter baumannii AB0057 Site: position = -83 score = 5.98369 sequence = TAACTTGTATATACATGTTT Gene: AB57_1739: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
|
|
Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| CRON 3. | |||||
| hutC |
|
|
|
*
Psychrobacter sp. PRwf-1 Site: position = -156 score = 4.99599 sequence = GATTTTGTATATACAAATTA Gene: PsycPRwf_0853: Histidine utilization repressor, GntR family |
Histidine utilization repressor, GntR family |
| CRON 4. | |||||
| hutC |
|
*
Acinetobacter baumannii AB0057 Site: position = -67 score = 4.48849 sequence = GTGGTTGTATATACATAGCA Gene: AB57_3862: Histidine utilization repressor, GntR family |
|
|
Histidine utilization repressor, GntR family |
| hutD |
|
Gene: AB57_3861: Conserved hypothetical protein related to histidine degradation |
|
|
Conserved hypothetical protein related to histidine degradation |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |