Regulon of HutC in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO5172
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 5.3 Sequence: TAATTTGTATATACATATAC Locus tag: PSPTO5172 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: PSPTO5173 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
	PSPTO5172	hutC	Histidine utilization repressor, GntR family
	PSPTO5173	hutD	Conserved hypothetical protein related to histidine degradation
Position: -41 Score: 5 Sequence: GTATATGTATATACAAATTA Locus tag: PSPTO5171 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	PSPTO5171	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Position: -10 Score: 4.6 Sequence: TTGATTGCATATGCTTGTAT Position: 0 Score: 5.9 Sequence: ATGCTTGTATGTACAAGTAG Locus tag: PSPTO5270 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: PSPTO5271 Name: hutX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1) Locus tag: PSPTO5272 Name: hutW Funciton: Histidine ABC transporter, permease protein (TC 3.A.1) Locus tag: PSPTO5273 Name: hutV Funciton: Histidine ABC transporter, ATP-binding protein Locus tag: PSPTO5274 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: PSPTO5275 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: PSPTO5276 Name: hisT Funciton: Histidine transport protein (permease) Locus tag: PSPTO5277 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: PSPTO5278 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	PSPTO5270	hutU	Urocanate hydratase (EC 4.2.1.49)
	PSPTO5271	hutX	Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
	PSPTO5272	hutW	Histidine ABC transporter, permease protein (TC 3.A.1)
	PSPTO5273	hutV	Histidine ABC transporter, ATP-binding protein
	PSPTO5274	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	PSPTO5275	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	PSPTO5276	hisT	Histidine transport protein (permease)
	PSPTO5277	hutI	Imidazolonepropionase (EC 3.5.2.7)
	PSPTO5278	hutG	N-formylglutamate deformylase (EC 3.5.1.68)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD