Regulon of HutC in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA5105
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Pseudomonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.4 Sequence: TTATTTGTATATACATATAC Locus tag: PA5105 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: PA5104 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
	PA5105	hutC	Histidine utilization repressor, GntR family
	PA5104	hutD	Conserved hypothetical protein related to histidine degradation
Position: -43 Score: 5.4 Sequence: GTATATGTATATACAAATAA Locus tag: PA5106 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	PA5106	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Position: -121 Score: 5.9 Sequence: ATACTTGTATGTACAAGCAT Locus tag: PA5100 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: PA5099 Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein Locus tag: PA5098 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: PA5097 Name: hisT Funciton: Histidine transport protein (permease) Locus tag: PA5096 Name: hutX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1) Locus tag: PA5095 Name: hutW Funciton: Histidine ABC transporter, permease protein (TC 3.A.1) Locus tag: PA5094 Name: hutV Funciton: Histidine ABC transporter, ATP-binding protein Locus tag: PA5093 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: PA5092 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: PA5091 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	PA5100	hutU	Urocanate hydratase (EC 4.2.1.49)
	PA5099	COG1457 (CodB)	Permease, cytosine/purines, uracil, thiamine, allantoin family protein
	PA5098	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	PA5097	hisT	Histidine transport protein (permease)
	PA5096	hutX	Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
	PA5095	hutW	Histidine ABC transporter, permease protein (TC 3.A.1)
	PA5094	hutV	Histidine ABC transporter, ATP-binding protein
	PA5093	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	PA5092	hutI	Imidazolonepropionase (EC 3.5.2.7)
	PA5091	hutG	N-formylglutamate deformylase (EC 3.5.1.68)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD