Regulon of LldR in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03010985, Magn03010148
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Lactate utilization
Effector:	L-lactate
Regulog:	LldR - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - LldR
By TF family - GntR/Others
By effector - L-lactate
By pathway - Lactate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.6 Sequence: GTGGTAACAAAATTTGACCAG Locus tag: Magn03010148 Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family
	Magn03010148	lldR	Lactate-responsive regulator LldR, GntR family
Position: -96 Score: 5.3 Sequence: CTGGTCAAATTTTGTTACCAC Locus tag: Magn03010149 Name: lldP Funciton: L-lactate permease
	Magn03010149	lldP	L-lactate permease
Position: -117 Score: 5.8 Sequence: TTGGCAAAATAATTTTACCAC Locus tag: Magn03010147 Name: lldE Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
	Magn03010147	lldE	L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
Position: -118 Score: 4.7 Sequence: GTGGATAAAACTTTTTACCAC Locus tag: Magn03010985 Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family
	Magn03010985	lldR	Lactate-responsive regulator LldR, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD