Regulon of LldR in Rhodospirillum rubrum ATCC 11170

Properties
Regulator type:	Transcription factor
TF locus tag:	Rru_A1414
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Lactate utilization
Effector:	L-lactate
Regulog:	LldR - Rhodospirillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - LldR
By TF family - GntR/Others
By effector - L-lactate
By pathway - Lactate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 5.9 Sequence: TTGGTCAAGAAGTATGACCAC Locus tag: Rru_A1414 Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family
	Rru_A1414	lldR	Lactate-responsive regulator LldR, GntR family
Position: -241 Score: 6 Sequence: GTGGTCATACTTCTTGACCAA Locus tag: Rru_A1413 Name: lldE Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE Locus tag: Rru_A1412 Name: lldF Funciton: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF Locus tag: Rru_A1411 Name: lldG Funciton: L-lactate dehydrogenase, subunit LldG Locus tag: Rru_A1410 Name: dld Funciton: D-lactate dehydrogenase Locus tag: Rru_A1409 Name: lldP Funciton: L-lactate permease
	Rru_A1413	lldE	L-lactate dehydrogenase, Fe-S oxidoreductase subunit LldE
	Rru_A1412	lldF	L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit LldF
	Rru_A1411	lldG	L-lactate dehydrogenase, subunit LldG
	Rru_A1410	dld	D-lactate dehydrogenase
	Rru_A1409	lldP	L-lactate permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD