Regulon of Zur in Granulibacter bethesdensis CGDNIH1

Properties
Regulator type:	Transcription factor
TF locus tag:	GbCGDNIH1_1212
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 5.9 Sequence: TATATGTTATAACATAACACAAT Locus tag: GbCGDNIH1_1210 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: GbCGDNIH1_1209 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: GbCGDNIH1_1208 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	GbCGDNIH1_1210	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	GbCGDNIH1_1209	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	GbCGDNIH1_1208	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -63 Score: 6.1 Sequence: TGTTTGTTATGTTATAACATAAC Locus tag: GbCGDNIH1_0784 Name: PF08856 Funciton: Hypothetical protein
	GbCGDNIH1_0784	PF08856	Hypothetical protein
Position: -28 Score: 6.1 Sequence: AACATGTCATGTTATAACATAAC Locus tag: GbCGDNIH1_1357 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	GbCGDNIH1_1357	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -57 Score: 6.4 Sequence: TAAACGTTATGTTATAACATAAC Locus tag: GbCGDNIH1_1545 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	GbCGDNIH1_1545	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD