Regulon of Zur in Gluconobacter oxydans 621H

Properties
Regulator type:	Transcription factor
TF locus tag:	GOX0811
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.4 Sequence: TGATCATTATGTTATAACATAAC Locus tag: GOX2213 Name: PF08856 Funciton: Hypothetical protein
	GOX2213	PF08856	Hypothetical protein
Position: -178 Score: 5.6 Sequence: ATTATGTTATATCATAACAGTTC Locus tag: GOX0562 Name: omr1 Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	GOX0562	omr1	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -80 Score: 6.4 Sequence: GAACTGTTATGATATAACATAAT Locus tag: GOX0561 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	GOX0561	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -50 Score: 5.3 Sequence: GATGTGTTACTTTATAACGCTAC Locus tag: GOX1044 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: GOX1045 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: GOX1046 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	GOX1044	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	GOX1045	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	GOX1046	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -73 Score: 6.1 Sequence: CGATTGTTATGTTATAACATAAT Locus tag: GOX2212 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	GOX2212	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD