Regulon of Zur in Acetobacter pasteurianus IFO 3283-01

Properties
Regulator type:	Transcription factor
TF locus tag:	APA01_22640
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.8 Sequence: AAAATGTAATAGTATTACATTGC Locus tag: APA01_22630 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: APA01_22620 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: APA01_22610 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	APA01_22630	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	APA01_22620	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	APA01_22610	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -66 Score: 5.9 Sequence: GTAATGTTATAGTGTTACATAAT Locus tag: APA01_04190 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	APA01_04190	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -105 Score: 5.7 Sequence: GCAATGTAATACTATTACATTTT Locus tag: APA01_22640 Name: zur Funciton: Zinc uptake regulation protein Zur
	APA01_22640	zur	Zinc uptake regulation protein Zur

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD