Regulon of Zur in Gluconacetobacter diazotrophicus PAl 5

Properties
Regulator type:	Transcription factor
TF locus tag:	Gdia_1959
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.6 Sequence: ACTATGTTATAATGTAACAAATA Locus tag: Gdia_1959 Name: zur Funciton: Zinc uptake regulation protein Zur
	Gdia_1959	zur	Zinc uptake regulation protein Zur
Position: -89 Score: 4.6 Sequence: GAAACGTTATATCATACGGTTTA Locus tag: Gdia_1456 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Gdia_1456	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -75 Score: 6 Sequence: TATTTGTTACATTATAACATAGT Locus tag: Gdia_1958 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Gdia_1957 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Gdia_1956 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Gdia_1958	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Gdia_1957	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	Gdia_1956	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD