Regulon of Zur in Rhodospirillum centenum SW

Properties
Regulator type:	Transcription factor
TF locus tag:	RC1_0590
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.9 Sequence: CAAATGTTATAATATAACGATCT Locus tag: RC1_3161 Name: znuA3 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RC1_3161	znuA3	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -75 Score: 5.8 Sequence: AGATCGTTATATTATAACATTTG Locus tag: RC1_3160 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: RC1_3159 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	RC1_3160	znuC3	ABC-type Mn/Zn transport systems, ATPase component
	RC1_3159	znuB3	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -65 Score: 5.2 Sequence: GATACGTTATAACATCACGTACC Locus tag: RC1_3938 Name: omr2 Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	RC1_3938	omr2	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD