Regulon of Zur in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03007851, Magn03006409
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.9 Sequence: GAAATGTTATAATATAACATATC Locus tag: Magn03007851 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Magn03007852 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: Magn03007853 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Magn03007851	zur	Zinc uptake regulation protein Zur
	Magn03007852	znuC3	ABC-type Mn/Zn transport systems, ATPase component
	Magn03007853	znuB3	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -52 Score: 5.1 Sequence: GCGATGTGATAATGTTACATTAT Locus tag: Magn03000731 Name: znuA4 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Magn03000731	znuA4	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -53 Score: 6.8 Sequence: GATATGTTATATTATAACATTTC Locus tag: Magn03007850 Name: znuA3 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Magn03007850	znuA3	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD