Regulon of Zur in Rhodospirillum rubrum ATCC 11170

Properties
Regulator type:	Transcription factor
TF locus tag:	Rru_A1911
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -199 Score: 6 Sequence: AAAATGTGATGTTATAACGTTTT Locus tag: Rru_A3702 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Rru_A3703 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Rru_A3704 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Rru_A3702	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Rru_A3703	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Rru_A3704	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD