Regulon of Zur in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_0488
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6 Sequence: TTCGAGATACGTTATATCATTGC Locus tag: Bphy_0488 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Bphy_0487 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bphy_0486 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bphy_0485 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Bphy_0488	zur	Zinc uptake regulation protein Zur
	Bphy_0487	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bphy_0486	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bphy_0485	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD