Regulon of Zur in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_A0718
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.2 Sequence: ATCGAGATACGTTATATCATTGC Locus tag: Bxe_A0718 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Bxe_A0717 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bxe_A0716 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bxe_A0715 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Bxe_A0718	zur	Zinc uptake regulation protein Zur
	Bxe_A0717	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bxe_A0716	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bxe_A0715	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -165 Score: 4.9 Sequence: TGAATGTAATGATATAACATTCC Locus tag: Bxe_B0900 Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Bxe_B0899 Name: exbB Funciton: Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein Locus tag: Bxe_B0898 Name: exbD Funciton: Biopolymer transport protein ExbD/TolR Locus tag: Bxe_B0897 Name: tonB Funciton: Biopolymer transport protein, TonB protein
	Bxe_B0900	omr2	Predicted zinc-related TonB-dependent outer membrane transporter
	Bxe_B0899	exbB	Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein
	Bxe_B0898	exbD	Biopolymer transport protein ExbD/TolR
	Bxe_B0897	tonB	Biopolymer transport protein, TonB protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD