Regulon of Zur in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g29530
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.5 Sequence: GGCTGGATACGTTATATCATCCG Locus tag: bglu_1g29530 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: bglu_1g29540 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: bglu_1g29550 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: bglu_1g29560 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	bglu_1g29530	zur	Zinc uptake regulation protein Zur
	bglu_1g29540	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	bglu_1g29550	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	bglu_1g29560	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -197 Score: 5.9 Sequence: AAAATGATACGTTATATCGTGTC Locus tag: bglu_2g16600 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	bglu_2g16600	omr	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD