Regulon of Zur in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_2647
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.3 Sequence: AGGGAGATACGTTATATCATCGC Locus tag: Bamb_2647 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Bamb_2648 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bamb_2649 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bamb_2650 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Bamb_2647	zur	Zinc uptake regulation protein Zur
	Bamb_2648	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bamb_2649	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bamb_2650	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -217 Score: 5.8 Sequence: GAGATGATATAACATATCATTTC Locus tag: Bamb_3871 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	Bamb_3871	omr	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD